- Phone
-
Address
503, Unit 2, Building 3, Baicaoyuan, No. 128 Malianwa North Road, Haidian District, Beijing
Beijing Nuobolide Technology Co., Ltd
503, Unit 2, Building 3, Baicaoyuan, No. 128 Malianwa North Road, Haidian District, Beijing
Zero-Blunt Simple Quick Ligation Kit
pZERO-Blunt SimpleZero background flat end quick connect kit
(Excluding MCS
Principle of Zero Background Flat End Rapid Cloning Kit T4
Catalog Number: 42113
Composition, storage, and stability of the reagent kit:
Kit components |
20 times (42113-20) |
40 times (42113-40) |
Pzero-blunt simple vector (40 of / ml) |
20 ml |
40 ml |
1K bp Control(40ng/ml) |
5 ml |
5 ml |
2 ´ Quick Ligation Buffer |
100 ml |
200 ml |
Q 4 DNA ligase, 5 U / ml |
20 ml |
40 ml |
|
pZERO-Blunt Simple Forward Sequencing Primer (10µM) |
100 ml |
200 ml |
|
pZERO/Blunt Simple Reverse Sequencing Primer (10µM) |
100 ml |
200 ml |
Storage at -20 ℃ will not affect the effectiveness of use within 6 months.
Product Introduction
The zero background flat end rapid ligation kit is an excellent gene killing positive selective cloning system that can efficiently clone flat end PCR products and any DNA fragment with a flat end. This kit is effective for both phosphorylated and non phosphorylated DNA fragments. It only takes 5 minutes to obtain over 90% of positive recombinant clones by connecting the positive selection vector and insertion fragment. The flat end PCR product amplified by a polymerase with corrective activity (such as Pfu polymerase) can be directly ligated into a cloning vector. The connecting product can directly transform commonly used strains of Escherichia coli.
The reagent kit provides a novel gene killing positive selection cloning vector pZERO Blunt Simple. The vector contains a lethal zikilling gene. When the vector is successfully connected to the fragment, the zikilling gene cannot be expressed correctly, and cells containing the recombinant can grow normally; When the connection between the vector and the fragment is unsuccessful, the vector will self ligate and the killing gene will be correctly expressed. Cells containing self ligating empty vectors cannot survive, which is known as the "zero ZERO" background. This positive screening strategy does not require blue and white spot screening, greatly accelerating the cloning screening process.
PZERO Blunt Simple eliminates the presence of multiple cleavage sites near the insertion site, requiring the introduction of appropriate cleavage sites onto PCR amplification primers. At this point, if the enzyme cleavage site introduced by PCR amplification primers is used for DNA cleavage, the cleavage reaction will not be affected by restriction enzymes on other polyclonal cleavage sites on the T vector, which can greatly improve the efficiency of cleavage and increase the success rate of subcloning.
Operation steps:
1. Preparation for Connection Reaction:
The flat end PCR products or the flat end fragments after enzyme digestion can be separated and recovered by agarose gel electrophoresis (using long wave ultraviolet light or visible light transmission gel cutting to avoid DNA damage and connection failure). The molar ratio to the carrier is 3:1. The DNA product rapid purification and recovery kit produced by our company can effectively recover DNA fragments of over 70bp.
2. Quick connection response:
1) On a standard 10mConnect the reaction system and add 1mL 40, <NUM>#1 of pzero-blunt simple ChmPCR products (under normal circumstances, it is not necessary to accurately quantify PCR products. Generally, optimizing the molar ratio of PCR products to carriers to 1:1~10:1 can achieve good results, with a recommended ratio of 3:1, as shown in the appendix), 5ml 2´Quick alignment buffer and 0.9mL T4 DNA Ligase, the rest is supplemented with sterilized water.
The reaction proceeds according to the following system:
5ml |
2 ´Quick Ligation Buffer |
1ml |
PZERO Blunt Simple carrier |
Xml |
Purified PCR product/or 1ml 1000bp control |
Yml |
sterilized water |
0.9ml (5 Weiss Units/ml) |
Q 4 DNA ligase |
Final Volume |
10ml |
Usually, T4 DNA Ligase is added at the end.
2) Connect at 22 ℃ for 5-10 minutes (usually done on a PCR instrument).
It is usually recommended to connect at 22 ℃ for 5-10 minutes, and longer than 3kb segments can be extended to 30 minutes. Not recommended for more than 30 minutes, as exceeding it may reduce the number of conversions.
3) Cool on ice and then convert or store at -20 ℃.
3. Conversion:
1) 100mL competent cells were placed on ice, and after thawing, they were lightly brushed several times to evenly suspend the cells.
2) Join 4-5mConnect the liquid (up to a maximum of all can be added, as long as the volume of the connecting liquid does not exceed 1/10 of the volume of the competent cells), gently mix well. Leave it on ice for 30 minutes.
3) Heat shock in a 42 ℃ water bath for 90 seconds. Leave on ice for 2-3 minutes.
4) Add 500mLB or SOC medium (without antibiotics), shake at 37 ℃ and 150 rpm for 60 minutes.
5) Take 200mBacterial coating on ampicillin su (100)mG/ml) on a tablet.
The amount of bacteria to be coated should be adjusted appropriately based on the efficiency of the connection and the sensitivity of the competent cells. If the expected number of clones is small, a portion of the culture medium can be removed by centrifugation (4000rpm, 2 minutes), leaving an appropriate amount of culture medium to suspend the bacterial cells. Then, all or an appropriate amount of the bacterial cells can be coated on a plate (the remaining bacterial solution can be stored at 4 degrees Celsius, and if the number of transformed colonies is small on the second day, all the remaining bacterial solution can be coated on a new culture plate).
6) Place the plate forward at 37 ℃ for 1 hour to absorb excess liquid, then invert and culture overnight.
4. Filter:
5. Routine testing: Inoculate the obtained colonies with 1-5 ml LB (containing a final concentration of 100)mG/ml ampicillin (Su) medium was shaken overnight at 37 ℃ to preserve the bacterial strain. Plasmids were extracted and the inserted fragments were identified for correctness using PCR or enzyme digestion methods.
6. Quick detection: Select colonies and perform PCR detection directly (refer to Molecular Cloning Version 3 or refer to the instructions of our company's CV05 General T Vector Colony PCR Identification Kit).
7. Sequencing identification: Use the kit's own primers or T7 promoter primers to sequence and determine if the target clone is present.
This kit comes with sequencing primers (also used for colony PCR identification primers):
Forward sequencing primer, 23-mer |
5 ’ - cgactcactatagtc - 3 ’ |
Reverse sequencing primer, 24-mer |
5 ’ - aagaacatcgcttttcgatggcag - 3 ’ |
Appendix:
at How to calculate the amount of PCR product required for the linkage reaction?
Optimizing the molar ratio of PCR product to vector to 1:1~10:1 (recommended 3:1) can achieve good results, and the following formula can be used:
[Amount of vector added (ng) x size of inserted fragment (kb) ÷ size of vector (kb)] x molar ratio of inserted fragment to vector=amount of inserted fragment (ng). For example, the molar ratio of inserted fragment to vector is 3:1. If 40ng of vector is added in the ligation reaction and the size of inserted fragment is 500bp, the amount of inserted fragment should be [40ng vector x 0.5kb inserted fragment ÷ 2.974kb vector] x 3/1=20.2ng.
Principle of Zero Background Flat End Rapid Cloning Kit T4