One Step Gibson Cloning Kit for seamless cloning

One Step Gibson Cloning Kit

(Can connect 1-5 segments)

One Step Gibson Cloning Kit for seamless cloning

Catalog Number:42112

Packaging quantity:

Product storage:-20°CSave and avoid repeated freezing and thawing

Product Description: This product does not rely onT4Ligase, not limited by the cleavage sites of the vector and target fragment, can be directly recombined using overlapping fragments. By using a special enzyme combination, any linearized vector and its two ends can be linearized15-25bpOverlapping areasPCRSegments (flat end) directed recombination can be quickly achieved1-5Efficient and seamless cloning of fragments.

Product Features:

1. 30Minutes can be divided into one or more long and shortPCRInsert the amplified fragment (flat end) into the vector.

2. Not affected by the availability of enzyme cleavage sites for vectors and insertion fragments, and by the flat end of the vector/The restriction of sticky end can be cloned at any site.

3.Seamless cloning, insertion points will not introduce unwanted base sequences.

4.Efficient, accurate, positive rate>95%.

Preparation of linearized vectors and inserted DNA fragments:

A: Preparation of Linearized Carrier

(1). Enzyme digestion source:The linear carrier obtained by enzyme digestion can be either flat end or sticky end, single enzyme digestion or double enzyme digestion, and the gel can be recovered after enzyme digestion.

Note: There is no double stranded DNA ligase in the seamless splicing and cloning reaction system, and no carrier self ligation reaction will occur. Therefore, even linearized carriers prepared by single enzyme digestion do not require terminal dephosphorylation treatment. The false positive clones (without inserted fragments) that appear after the transformation of recombinant products are formed by the conversion of non linearized circular vectors by enzymes. We recommend enzyme digestion followed by gel recovery to reduce the proportion of this non linearized carrier to the lowest possible level.

(2). Reverse PCR source:It is recommended to use high fidelity DNA polymerase (item number: P517-05) for preparation. If the amplification band is single, the vector can be obtained by purifying the PCR product (item number: DC012-100). Otherwise, the vector can be obtained by gel recovery (item number: DC011-100).

Note: The plasmid template for reverse PCR is also a non-linear vector, which may lead to false positive clones (without inserted fragments). Therefore, digesting the plasmid template with Dpn I endonuclease before purifying the PCR derived linear vector (PCR product) can reduce background and increase positivity rate. However, in general, gel recovery is sufficient to reduce the proportion of non linearized carriers to the lowest possible level. Therefore, we also recommend gel recovery for linearized carriers derived from reverse PCR.

B: Preparation of inserted DNA fragments

(1). Single insertion fragment cloning primer design: Cloning primers include insertion fragment specific primer sequences and overlapping sequences.

Cloning forward primers (5 '-3'): linear vector forward 16-25 nt overlap region sequence (counted from the 3 'end)+insertion fragment forward specific primer sequence (18-25 nt)

Cloning Reverse Primer (5 '-3'): Linear Vector Reverse 16-25 nt Overlap Region Sequence (from 3 'End)+Insertion Fragment Reverse Specific Primer Sequence (18-25 nt)

Note:The base number of the overlapping region should be at least 16 bp, and the Tm value between multiple overlapping regions should be consistent and>60 ° C (AT pair=2 ° C and GC pair=4 ° C), otherwise the base number can be extended until it meets the requirements.

According to the structure of the linear carrier end (5 'protrusion, 3' protrusion, flat end), primer design can also be divided into three situations

The two ends of the linearized vector can be any combination of the three terminal structures mentioned above due to different linear methods (such as single enzyme digestion, double enzyme digestion, reverse PCR). The principle of designing insert fragment specific primers should follow the general principles of primer design.

When calculating the annealing temperature of amplification primers, only the Tm value of the gene specific amplification sequence needs to be calculated, and the homologous sequence at the end of the vector should not be included in the calculation.

According to the above design principles, starting from the 3 'end, calculate back 16bp-25bp (this example uses a 20 bp end overlapping sequence), and add it before the target fragment specific primer sequence. Ensure that the Tm value of the overlapping area remains consistent and>60 ° C (AT pair=2 ° C and GC pair=4 ° C).

The specific forward primers are as follows: 5 'GAGCCTAGGTGAGTTGGCCGNNNNNNNNNNNNNNNNNNNN 3'

Note: After the above primer designs are cloned and connected, the EcoR I enzyme cleavage site will disappear (without retaining the cleavage site).

If retention is required The EcoR I enzyme cleavage site requires filling in the missing EcoR I recognition site sequence aattc between the 20 bp overlap sequence at the end of the vector and the target fragment specific primer sequence,After completing the cloning connection, the EcoR I cleavage site still exists (retaining the cleavage site).

Specifically, as follows: 5 'GAGCCTAGGTGAGTTGGCCG aattc NNNNNNNNNNNNNNNNNNNN 3'

The carrier is cleaved by Hind III enzyme to form a 5 'protruding end:

According to the above design principles, starting from the 3 'end, calculate back 16bp-25bp (this example uses a 20 bp end overlapping sequence), and add it before the target fragment specific primer sequence. Ensure that the Tm value of the overlapping area remains consistent and>60 ° C (AT pair=2 ° C and GC pair=4 ° C).

The specific reverse primers are as follows: 5 'CTGCCATCGGATCGTTCGCANNNNNNNNNNNNNNNNNNNN 3'

Note: After the above primer designs are cloned and connected, the Hind III cleavage site will disappear (without retaining the enzyme cleavage site).

If retention is required The Hind III cleavage site requires filling in the missing Hind III recognition site sequence agctt between the 20 bp overlap sequence at the end of the vector and the target fragment specific primer sequence ，The Hind III cleavage site still exists (retaining the cleavage site).

Specifically, as follows: 5 'CTGCCATCGGATCGTTCGCA agctt NNNNNNNNNNNNNNNNNNNN 3'

(2). Cloning Primer Design for Multiple Insertion Fragments: The Primer Design Method for Insertion Fragments Connected to Both Ends of the Vector is the same as the Single Fragment Design Method

*There are two ways to design the overlapping area between multiple inserted fragments using the above * markers (blue and red). When designing multi fragment primers, either one or a combination of both methods can be chosen to ensure a 15-25bp overlap area between fragments.

(3). Enzyme selection: It is recommended to use high fidelity DNA polymerase or PCR Mix (item number: P517-05 or P814-05).

(4). Reaction conditions: Generally, follow the instructions for the specific polymerase used.

(5). Purification insertion fragment

lOptional:If the fragment is derived from a plasmid template and the plasmid has the same resistance as the recombinant vector, digesting the plasmid template with Dpn I endonuclease before purification can reduce the background and increase the positivity rate.

lIf the fragment is single, it is recommended to purify the fragment using PCR product purification kit (item number: 43012-100).

lIf there is non-specific amplification, it is recommended to use a gel recovery kit (item number: 43011-100) to recover the fragment.

lUsing this method for cloning, the enzyme cleavage sites used to linearize the vector may be missing during splicing. If there are strict requirements for the enzyme cleavage sites, it is recommended to Pay attention to the selection of enzyme cleavage sites, and if necessary, you canBetween the overlapping region sequence of forward and reverse cloning primers and the specific gene sequenceAdd missing bases to restore the original enzyme cleavage site (see the example of forward and reverse primer design mentioned above).

lIf recombinant plasmids are used for protein expression, attention should be paid to ensuring that the reading frames, protein expression, and purification sequences (such as promoters, RBS sequences, start codons, stop codons, protein tags, etc.) are not disrupted during primer design.

Operation steps for seamless cloning reaction:

Attention: 2 x Cloning Master Mix contains a connection enhancer PEG, which is very viscous. When taken out of the refrigerator at low temperatures, it becomes even more viscous. You can freeze it in your palm for a few minutes and increase the temperature to reduce viscosity (without affecting quality)Mix thoroughly at the bottom of the centrifuge tube or vortex and shake thoroughly.

1. Establish a reaction system according to the table below (PCR tubes can be used to prepare at room temperature)

*The carrier is generally used at 10-50 ng, and the optimal molar ratio of the inserted fragment to the carrier is between 2:1-3:1; If the inserted fragment is less than 200bp, the molar ratio of the inserted fragment to the carrier is 5:1. In the case of multi fragment ligation, the molar ratio between fragments is 1:1.

2. Gently mix well, at 50°C reaction takes 15 minutes (can be performed on a PCR instrument). After the reaction is complete, place the PCR tube on ice and directly convert or store it in -20 ° C°C. Connecting more than 3 fragments can extend the reaction time to 30 minutes.

3. Take 5 μ l of the reaction product and convert it according to the instructions of the competent cells (if there are few transformants, all the products can be converted and the conversion solution can be coated on a plate).

Identification of positive clones:

Depending on the specific situation, colony PCR identification and plasmid extraction (item number 31011-100) can be selected for restriction enzyme identification or sequencing identification.

One Step Gibson Cloning Kit for seamless cloning