- Phone
-
Address
Haidian District, Beijing
Beijing Nuobolide Technology Co., Ltd
Haidian District, Beijing
NoboledeOne Step Seamless Cloning Kit
One Step Seamless Cloning Kit (Single segment)
Catalog Number:42111
Packaging quantity:
Components |
42111-20(20Next time) |
42111-50(50Next time) |
2 × One Step Cloning Mix |
50μl × 2 |
250μl |
Product storage:-20°C storage, avoid repeated freezing and thawing
The specific product parameters are subject to the parameters in the product manual received
Product Description:One step seamless cloning kit does not rely onT4Ligase, not limited by the cleavage sites of the vector and target fragment, can be directly recombined using overlapping fragments. By using a special enzyme combination, any linearized vector and its two ends can be linearized16-25bpOverlapping areasPCRFragment directed recombination connection, can30Implemented within minutesAEnd or flat endPCREfficient directed seamless cloning of product fragments to any site of the vector.
Product Features:
1. 30A minute can take one50bp-15kb PCRAmplification fragment (flat)/AClone and insert into any vector at any position.
2.Not affected by the availability of vectors and insertion fragment cleavage sitesPeaceful end/粘性末端的限Cloning can be performed at any location.
3. Seamless cloning, insertion points will not introduce unwanted base sequences.
4. Not dependent on ligases and phosphatases, efficient, accurate, with a cloning positivity rate of up to95%The above.
Schematic diagram of the principle of one-step seamless cloning kit:
Linearization carrier and insertionDNAPreparation of fragments:
APreparation of Linearized Carrier
(1).Enzyme digestion source:The linear carrier obtained by enzyme digestion can be either flat end or sticky end, single enzyme digestion or double enzyme digestion, and the gel can be recovered after enzyme digestion.
Note: There are no double chains in the one-step seamless cloning reaction systemDNALigase does not undergo carrier self ligation reaction. Therefore, even linearized carriers prepared by single enzyme digestion do not require terminal dephosphorylation treatment. False positive clones appearing after the transformation of recombinant products(No inserted fragments)It is formed by the conversion of non linearized circular carriers that cannot be fully digested by enzymes. We recommend enzyme digestion followed by gel recovery to minimize the proportion of this non linearized carrier.
(2).reversePCRSource:Suggest using high fidelityDNAPolymerase (item number:P517-05orP812-05)Preparation, if the amplification band is single, it can be achieved throughPCRProduct purification (item number:DC012-50)Obtain the carrier, otherwise recycle it through adhesive (item number:DC011-50)Obtain the carrier.
Note: ReversePCRThe plasmid template is also a non-linear vector, which may lead to false positive clones (without inserted fragments), thereforePCRSource Linear Carrier(PCRUsed before purification of the productDpn IDigesting plasmid templates with endonucleases can reduce background and increase positivity rates. However, in general, the recovery of the adhesive is sufficient to reduce the proportion of this non linearized carrier to its maximum, so the reverse is necessaryPCRWe also recommend rubber recycling for the linearized carrier of the source.
B: InsertDNAPreparation of fragments
(1).The general principle of one-step seamless cloning primer design is: through the use of primers5’Introducing a linearized cloning vector with homologous sequences at the end of the insertion fragment to amplify the product5’and3’At the very end, there are complete sequences that are consistent with the two ends of the linearized cloning vector(16 bp~20 bp).
(2).Insertion fragment primer design: Cloning primers include insertion fragment specific primer sequences and overlapping sequences.
Clone forward primers(5’-3’)Linear carrier forward16-25 ntOverlapping region sequence(3’Starting from the end)+Insert fragment forward specific primer sequence(18-25 nt)
Clone reverse primers(5’-3’): Linear carrier reverse16-25 ntOverlapping region sequence(3’Starting from the end)+Insert fragment reverse specific primer sequence(18-25 nt)
Attention: The base number in the overlapping area should be at least16 bpAnd the overlapping areas between multiple segmentsTmThe value needs to be consistent and>60°C (AT pair = 2°C and GC pair = 4°C)Otherwise, the number of bases can be extended until it meets the requirements.
According to the structure of the linear carrier end(5’Highlight,3’Highlight, flat end), primer design also includes3The situation is illustrated as follows:
The two ends of the linearized carrier are affected by linear methods (such as single enzyme digestion, double enzyme digestion, reverse)PCR)Different, it can be any combination of the three terminal structures mentioned above, and the principle of designing insert fragment specific primers should follow the general principles of primer design.
When calculating the annealing temperature of amplification primers, only the gene specific amplification sequence needs to be calculatedTmThe homologous sequence at the end of the vector should not be included in the calculation.
(3).Enzyme selection: It is recommended to use high fidelityDNAPolymerase orPCR Mix(Item number:P517-05orP814-05).
(4).Reaction conditions: Generally, follow the instructions for the specific polymerase used.
(5).Purification insertion fragment
l Optional: If the fragment is derived from a plasmid template and the plasmid has the same resistance as the recombinant vector, use before purificationDpn IDigesting plasmid templates with endonucleases can reduce background and increase positivity rates.
l If the fragment is single, it is recommended to usePCRProduct Purification Kit (Product Code:DC012-100)Purification fragment.
l If there is non-specific amplification, it is recommended to use a gel recovery kit (item number:DC011-100)Recycling fragments.
l When using this method for cloning, the enzyme cleavage sites used to linearize the vector may be missing during splicing. If there are strict requirements for the enzyme cleavage sites, it is recommended to pay attention to the selection of enzyme cleavage sites, and if necessary, they can be addedBetween the overlapping region sequence of forward and reverse cloning primers and the specific gene sequenceAdd missing bases to restore the original enzyme cleavage site (see examples below).
l If recombinant plasmids are used for protein expression, attention should be paid to the reading frame, protein expression, and purification required sequences (such as promoters) during primer design,RBSThe sequence, start codon, stop codon, protein tag, etc. are not destroyed.
Example of Positive Primer Design(EcoR IEnzymatic incision):
As shown in the above figure, the carrier is composed ofEcor IEnzyme cleavage, forming5’Highlight the end:
Based on the above design principles, from3’Start calculating from the end, calculate back16bp-25bp(This example uses20 bpThe overlapping sequence at the end can be added before the specific primer sequence of the target fragment. Ensure overlapping areasTmThe value remains consistent and>60°C (AT pair = 2°C and GC pair = 4°C).
The specific forward primers are as follows:5'GAGCCTAGGTGAGTTGGCCGNNNNNNNNNNNNNNNNNNNN3'
Note: After the above primer designs are cloned and connected,EcoR IThe enzyme cleavage site will disappear (without retaining the enzyme cleavage site).
If retention is requiredEcoR IThe enzyme cleavage site needs to be located at the end of the carrier20 bpCompleting missing sequences between overlapping sequences and target fragment specific primer sequencesEcoR IIdentify site sequenceATTCAfter completing the clone connection,EcoR IThe enzyme cleavage site still exists (retaining the enzyme cleavage site).
as follows:5' GAGCCTAGGTGAGTTGGCCGaattc NNNNNNNNNNNNNNNNNNNN3'
Example of reverse primer design(Hind IIIEnzymatic incision):
As shown in the above figure, the carrier is composed ofHind IIIEnzyme cleavage, forming5’Highlight the end:
Based on the above design principles, from3’Start calculating from the end, calculate back16bp-25bp(This example uses20 bpThe overlapping sequence at the end can be added before the specific primer sequence of the target fragment. Ensure overlapping areasTmThe value remains consistent and>60°C (AT pair = 2°C and GC pair = 4°C).
The specific reverse primers are as follows:5'CTGCCATCGGATCGTTCGCANNNNNNNNNNNNNNNNNNNN 3'
Note: After the above primer designs are cloned and connected,Hind IIIThe cleavage site will disappear (without retaining the enzyme cleavage site).
If retention is requiredHind IIIThe enzyme cleavage site needs to be located at the end of the carrier20 bpCompleting missing sequences between overlapping sequences and target fragment specific primer sequencesHind IIIIdentify site sequenceagctt,Hind IIIThe enzyme cleavage site still exists (retaining the enzyme cleavage site).
as follows:5' CTGCCATCGGATCGTTCGCA agctt NNNNNNNNNNNNNNNNNNNN 3'
Operation steps for seamless cloning reaction:
Note:2 × OneStep Cloning MixContains connection enhancerPEGVery viscous, it becomes even more viscous when taken out of the refrigerator at low temperatures. You can freeze it in your palm for a few minutes and increase the temperature to reduce the viscosity (without affecting the quality). Gently mix and centrifuge to collect it at the bottom of the tube in an instant.
1. Establish a reaction system according to the following table (can be used)PCRTube prepared at room temperature
2 × One Step Cloning Mix |
5 μl |
Linear Vector (10-80 ng) |
X μl* |
Insert |
Y μl* |
dd H2O |
To 10 μl |
* Carriers are generally used20-50 ngThe molar ratio of insertion fragment to carrier is2:1-3:1The best between them; If the inserted segment is smaller than200bpThe molar ratio of insertion fragment to carrier is used5:1.
2. Gently mix well, then50°Creaction15Minutes (available in)PCROn the instrument, after the reaction is completePCRAfter placing the tube on ice, it can be directly transformed or stored-20°C. Shorter fragments such as100bp-1kbonly need15Sufficient transformants can be obtained in minutes, and longer fragments can be connected to extend the reaction time60minute
3. 取5μlThe reaction products are transformed according to the instructions of the competent cells (if there are few transformants, all products can be transformed and all transformation solutions can be coated on a plate).
Identification of positive clones:
Colony selection can be based on specific circumstancesPCRIdentification and extraction of plasmids (item number)31013-100)Perform restriction enzyme identification or sequencing identification.
One Step Seamless Cloning Kit